Home 10

Get immediate online homework help

We’re ready to provide solutions to your Homeworks, Computer & Programming, Web Development, Accounting & Math, Business & Finance questions. Download ready-to-download homework solutions that you can use.

Latest Homework Answers

Write a Python script to replace all review scores with their z scores, and based on these z scores, to drop all rows containing outliers. Specifically, you will need the…

Given this string that is the sequence: TGGTTTAGGGCCTATAATTGCAGGACCACTGGCCCTTGTCGAGGTGTACAGGTAGGGAGCTAAGTTCGAAACGCCCCTTGGTCGGGATTACCGCCATTCTAGTAGTCTAACCCCGAACGCGCTCAGGCTTTGAGTTCGCGCAGCATTAAGAAGTCCATGCCGGCACCGAATGTCCCGACGACAGGCAACCAGCACGGATACCCGCCTTGAAGGCGCAATCAGTAGGTCGAGTTACAGAGGCTCCCCCCGAGCTTGTGCTTCCATTGAGTAGGGGCTATAGATATGTAGCACTCAGGTTTAGTAGCGCCCTTTTAACAGCGAGAGCCCGCCTGGTCAGAACCGAACGGCTGATACGCGAGCTGATGGCTAGAGGATGAACACGGTCCTTCTCTTCGCTTCGATCCGGGGTAGTTTTGTAGCGAAGGATAACGCTCTGTGGATTCTCCGAGAATAATCATCAGTACGGTGTGCGTACCCTCTCTTTGATCCACGCCTGGGGCTGGACATAGTCAGGCGCATTTCATCTACTTAACCCCGGTAAGGGCCACGGGCGCGACATCTCCTTACCAGGGTTGTCTTATGCTCGCTTTTCCCAGATGATAAGCATCTCGTTGTAATGAACAGGTACCTAAGAAAACTGAGTTTCGACGACCCGTCGGCTCGTGTTCTTATCTATTGATCTAACCGAGGTGAAGCTCGCCAAAAATTTCGTAATGTAAGAGAGAAATTGAAGGGGTGAATTTTGCACTCTCGTGCATACGTCTTGCTACAATAGCAAGAGCTGTATGCGTGCGACCACTTCACTACCTCTATAGCATGCGATCTCGCAGCCCGGATTGTCGCCTCCTTTGGGCCGCAAAAACGGTATACGGACACACTGCATCTGTGAGCACGCACCAACTCGATGCGCGTAATAGGCATCTGCTCCACCCAGGGGGCAAGGGCACCTGAGGACGATCTGTTCCGAACAGTATATTTGAGCCAATGTTCTATTAGTGAAGGCAAGGTGAGGGCAACTCACACTGGTACCTCGAGGAGTAATCCGATCCATCTAAACTGGCATGCCCGTTCGAGCTCGGGGGGTTCTTGAATTTAGCTGCGTGTACCTCAGGTCTCCTGAAGGTGACACCAAAGTACAAGATAGATAGATAGATAGATAGGTAATATCTGACGTGAATTGCTTACCGCTAGTGAGCGATTTAGGTCACGTCCTCTGAAGATGTACCGTGATCATCGATGAAATGGCTCTGCAGAGCGTTGCTCTTAACTTAGTGGGAGTGTTCCTTTGCAGTCTGATGAAGTCGCTGCATGTTAACTTTGCACTAAGGGCGTTTCCGAACCCTATAGTCATCCTTATTGATTCGCCCTGTCTTACCCAGGATACACTACCGTTCGAGGCTCTTAACGTACCAACGCATGCAGTCAGAAGATGATTCACCATCCAAGCAAATCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTGGCTTTAAAGCACCGAATGTAGTTGGCCATCGGTCTCGGTCACCAATAAGACGGCCTCGTGGGTCACTCGGTCGATGATCTAGGGTCGGGTGCATAGTGTTTCAGGTCGGCGCTCAGGGTTCTTGTCAGGGAAATCTACGGGTGAGTTGGAAAGCGCCGCCAGCGAGATGCCTGTAGGCGATTAGTGTAGAGAGAGCAACATCGGAAAATTGTCCGTGGGGCGCTACGTAAGTGTTCCCAGTATTCTCGTCCAGAGTAAGTCATGCATACCAGTATCAGGCGTCTGTGTGTTACGTTGCAGTGTATCCCGGTAGCGGGAAGCGTATAGAGCGTAACAGACCTGTCCTACAGCACGCAGGATGTCGACCCTTTCTCAGGCACGATACTTCGTGTAACAGCAGTTCCGGTGTCATCTGTAACTGTTCTGTGTTCCATAGTGAAGATATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCGGGCGACCCTGGCAATCAGGCGCCTGCTTATATGACAATTTGTCGCAATACGGGTCGCAGATGTATTGTCCGCATGAGTTTACGGTATCCGGAACTGTCACCGCCGATCCAATATGATCGCAAATCGGGGTGACACAATGGACCGCCGTAGATAAACCCTGCGATGCTGCAATAAGGATATGATATCGCGCGCGGGCCGTAAAACCGATCTTGGAAGGCGGGAAGTCTCCGGGAAAAACTCTCTGATAAAGCCTATTACAAGAAGAGCTCGAAGGCAAGATGGGCATGCCCCGTCGACCACACGGGCAAGCTCTGAGAATCGATGTGGTCGCTTAACCAACCCATACGGAGTGAACGAGACCACGCGGGCGGTTCTTGGTACGCATGATTCCTATTGGTTCTGCCGGGCGTGTGCAGGATTGTTCACTCCCCACCCTGTCGCTCACGAACGCGCTGGTTGCTTAAACCGACCGGAAATTCTGTAGCCGCCCCGTAAGTTTAACGCTTTGAAATACTCCACATGTGCGTACCGGGTCTGATCGCTTACGTGGCGCCACTATGTTAGGAGCTCATAGATATCGATGAATCAAATGTCTTTCATCGCTCCTTAAACAACCTGACGTATTCGCAAAATTGCGCGTATTGAGAAGGGAAAGTTAAAGGAACGATAACAATGAGTCTGCTTTCACCGGCTGCATAACGGGATCGCGCGCTATGGGATTTCCTAACTATAATTCGTGTCGATACTCAGACGCGTTGTACAGGTAAGAAGTCGGCGGGACAGTATTTGAGAAGGGGCTCTGCGGCACCAACGCCGAGCTGTATCAGGGGGGTTAATGTGTAGCGGGCATATAACACAATACAGCCCGCGGCGCGTCGTGGTTACCGTAGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAACACCGGAGCTAGGATCCACGACTACCAGTGGGAAACTGTGAATTGTGCATGGTAATTAAAGGATGACTGGTCAACACCGGTCTCCACGGGCGTTAAACAACCTCGCTCCAGTCAATCTCTAGCGGTGGTTGTGGCAGCTTATTCCTGGAGGTAATACTCTTCCGGGCCCACTAAAAATGTAACGAAGTCGAGGTTGGGTCAGGGGATTGAGTGGGGGCGACTCACTGATTCCACCAGGAATTGTCGTCAATCGCGACGTACTTTGAGCCTTGTATCTTGGCGTTTCTTGTTGGTACGCGGCCGTGTTCGTGAATCACGACGTCGTTCATGATTCATCCGTCCAAGCCTAGACCTAGCGTAAAAACGGTGTCGATCTGTGCTCCAACCGATGGATGGTTTTTACACAAGTGAACTTCGAGGCTGTGGGACAAACAGCACAACTTGTTCACTGCTGACCGTGGTACTAAACCACGCTTGCTTTCAGCCCTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTCAGATGCGGATCAAGGGTTACTCGAGCCGTTCTGAGGTCCTAAAATTTTAGCCCTTGGTGTTAGCTTCGGTTTAAGAACGTAGGTGCGACGCGGGGGTCCTAGAGCTCCGCGATCTGCACTCCCCACCTGGCACCAAAACGAATCCTGCATAACGGCTCTCTGTGCATGGGGGATGGTCGCAACAACGAGCATAGCTGGCATCACTTCGTTTGCTGTGGATTGCTGTTTTATACAGAATACGGTGGTGATCATCAAAGGAAGCATAATCCACATCGGGCACCCCGGGCCATCGTGCGTTCCCTTATAGCCGGCTTGCATGTTGGGGGAGGAGTAAGGCCGGTAACGTCTCGCAGCACTGTCGCGTAACACAGGTACATCTTTATTTCCGGTGCTGTAGAAGTGGTTTTTCGAAGGCGTAACCCAGAACGACTGATATAATAGTCCACTATTCCCTGGTTTAAGACTTCTACAAAGTTTTACGCAAAGTTACATGCACACTCGGCGACGTAAATATTAGCCTTGCTAAATTGCCACGGATATTAATCCCGAGCCAACCTGTTCCCACTAGCGGTCTACGGTCATAGTCCTTTGTGTAGAGCGTCATTGCGGTTGGGGCCCGTCCGCGGAGGTTCCCCTTATGATCTAACCGCGGTGCAGGTTGACTGAATGCCATACACTATAGAGAAGACGTCTAAGTAGAAACGTTCTTTAAAAATCTTGAACTGACGGCCGAGTATTATCAAGAGAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCATGCACAATAAGGTTAGAAGCAGCAAGCATGTATTCTTTGCATAGAGGCGGTAAAGCCGCCTTGCATACCCAGCAGCAGCCGCGAAGGCCTTACTCCAGAGGACAGAACTTCTCACACAGCGTCCGCATACACCGCGGACGTGACAAGGTTAGATAGCTCTAGTTTGCGGCAACCCTCGCATCAGGCCGACTCACCCGCGCTTGCTACCCGGAGGATGGGTCAAGGGATAAACATAGCACGTTAGTTAAGCCTAACGTCAGTTTTTAGAGTTTACATGCACGACTAAGTGCATCGAAATACACGCCGTTGACAGACCAACAGCGTGTCAACTGGGCCTTGAGAATTGTATCATAATAGCCAAATACGAGGCCAAGTAGTCCGACGAGAGGCACGTAGAGACCACTTTCCCTAAACGATCTGTCGCATTACCCTTTGACTCGCACCCTATGCCTTATGTTCCAAGCAGCACCGAAGTTAGATTTAAGGGCGTATCTATCGGTACCTCGGTTGGGCCGGTCCACAGCTCCAGCTGAATTAGTGCTCACCCCGCTTCGAGGTTGAGTAAGGGTCACTTTTAAAAATATGCTTAAGGGTGATTCACATGACAGTAATCGAATAGTGAGATATAAGTAGGTGCGCCCCGCGCACACATCAAAACTGTGCAGACTGAAACTGAATGCTGGAGGCTGAGGAAAATGAAGATCAGAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGAGAAGAGTGAATGAATAGATCTGCCGCTGAATCCCCGCGTGAGGTTTTTGCGAC Get the maximum consecutive occurrences of the pattern “AGATC” The result should be 37 because it’s the maximum consecutive occurrences given that…

Project Objectives: The final project will require students to master and apply the core python concepts and programming skills acquired during the semester. Students will also apply critical thinking, problem-solving,…

Write a Java program to do the following :• Use this file for input movies.txt (see attached file)• Load the records to an array• Sort the movies by Year• Report1…

Here is a skeleton for a class representing a student. Complete the Student class by filling in the methods. A student has four properties -- his/her name (a string), year…

Design a Savings Account class that stores a savings account's annual interest rate and balance. The class constructor should accept the amount of the savings account's starting bal ance. The…

Jukebox HeroIn this problem, you will be creating a dictionary that will store album names and a list of songs on that album.First, start by creating a Dictionary that will…

Write a program called Lab19C that searches for a number in an array. a. Write a bool function named search that receives 3 parameters: an int array, an int containing…

Object Oriented Practice Problem Create a UML Diagram that provides design specifications for a list of objects. Design a class of objects to keep track of any one of the…

×
New Download