Home 10

Get immediate online homework help

We’re ready to provide solutions to your Homeworks, Computer & Programming, Web Development, Accounting & Math, Business & Finance questions. Download ready-to-download homework solutions that you can use.

Latest Homework Answers

Write a program that declares a 20-element, one-dimensional int array called commission. Assign the following 20 numbers to the array: 30, 115, 131, 152, 180, 210, 220, 310, 319, 431,…

Write an address book application that presents a menu to the user and allows them to update and print their contacts. You should use a dictionary to complete this problem.…

Write a class definition, named Person. Declare attributes (instance variables) name, age, and school affiliation. Then define the associated methods (behavior). Write a constructor that takes a name and stores…

Write valid Python code to implement the design shown in the following flow chart. The problem is provided to help make the flow chart clearer, but you are not expected…

In a Visual Studio C++ project named using the format firstnerne_lastname_0201 Bi-dimensional Array Create a bi-dimensional float array with 2 rows and 3 ++I++++ (2+3). Each row represents a circle.…

Problem #1: Baking Converter Convert a given weight to either ounces or grams. Set the weight amount. Set a variable for either ounces or grams. Use a "g" or "oz".…

Write a Python script to replace all review scores with their z scores, and based on these z scores, to drop all rows containing outliers. Specifically, you will need the…

Given this string that is the sequence: TGGTTTAGGGCCTATAATTGCAGGACCACTGGCCCTTGTCGAGGTGTACAGGTAGGGAGCTAAGTTCGAAACGCCCCTTGGTCGGGATTACCGCCATTCTAGTAGTCTAACCCCGAACGCGCTCAGGCTTTGAGTTCGCGCAGCATTAAGAAGTCCATGCCGGCACCGAATGTCCCGACGACAGGCAACCAGCACGGATACCCGCCTTGAAGGCGCAATCAGTAGGTCGAGTTACAGAGGCTCCCCCCGAGCTTGTGCTTCCATTGAGTAGGGGCTATAGATATGTAGCACTCAGGTTTAGTAGCGCCCTTTTAACAGCGAGAGCCCGCCTGGTCAGAACCGAACGGCTGATACGCGAGCTGATGGCTAGAGGATGAACACGGTCCTTCTCTTCGCTTCGATCCGGGGTAGTTTTGTAGCGAAGGATAACGCTCTGTGGATTCTCCGAGAATAATCATCAGTACGGTGTGCGTACCCTCTCTTTGATCCACGCCTGGGGCTGGACATAGTCAGGCGCATTTCATCTACTTAACCCCGGTAAGGGCCACGGGCGCGACATCTCCTTACCAGGGTTGTCTTATGCTCGCTTTTCCCAGATGATAAGCATCTCGTTGTAATGAACAGGTACCTAAGAAAACTGAGTTTCGACGACCCGTCGGCTCGTGTTCTTATCTATTGATCTAACCGAGGTGAAGCTCGCCAAAAATTTCGTAATGTAAGAGAGAAATTGAAGGGGTGAATTTTGCACTCTCGTGCATACGTCTTGCTACAATAGCAAGAGCTGTATGCGTGCGACCACTTCACTACCTCTATAGCATGCGATCTCGCAGCCCGGATTGTCGCCTCCTTTGGGCCGCAAAAACGGTATACGGACACACTGCATCTGTGAGCACGCACCAACTCGATGCGCGTAATAGGCATCTGCTCCACCCAGGGGGCAAGGGCACCTGAGGACGATCTGTTCCGAACAGTATATTTGAGCCAATGTTCTATTAGTGAAGGCAAGGTGAGGGCAACTCACACTGGTACCTCGAGGAGTAATCCGATCCATCTAAACTGGCATGCCCGTTCGAGCTCGGGGGGTTCTTGAATTTAGCTGCGTGTACCTCAGGTCTCCTGAAGGTGACACCAAAGTACAAGATAGATAGATAGATAGATAGGTAATATCTGACGTGAATTGCTTACCGCTAGTGAGCGATTTAGGTCACGTCCTCTGAAGATGTACCGTGATCATCGATGAAATGGCTCTGCAGAGCGTTGCTCTTAACTTAGTGGGAGTGTTCCTTTGCAGTCTGATGAAGTCGCTGCATGTTAACTTTGCACTAAGGGCGTTTCCGAACCCTATAGTCATCCTTATTGATTCGCCCTGTCTTACCCAGGATACACTACCGTTCGAGGCTCTTAACGTACCAACGCATGCAGTCAGAAGATGATTCACCATCCAAGCAAATCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTGGCTTTAAAGCACCGAATGTAGTTGGCCATCGGTCTCGGTCACCAATAAGACGGCCTCGTGGGTCACTCGGTCGATGATCTAGGGTCGGGTGCATAGTGTTTCAGGTCGGCGCTCAGGGTTCTTGTCAGGGAAATCTACGGGTGAGTTGGAAAGCGCCGCCAGCGAGATGCCTGTAGGCGATTAGTGTAGAGAGAGCAACATCGGAAAATTGTCCGTGGGGCGCTACGTAAGTGTTCCCAGTATTCTCGTCCAGAGTAAGTCATGCATACCAGTATCAGGCGTCTGTGTGTTACGTTGCAGTGTATCCCGGTAGCGGGAAGCGTATAGAGCGTAACAGACCTGTCCTACAGCACGCAGGATGTCGACCCTTTCTCAGGCACGATACTTCGTGTAACAGCAGTTCCGGTGTCATCTGTAACTGTTCTGTGTTCCATAGTGAAGATATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCGGGCGACCCTGGCAATCAGGCGCCTGCTTATATGACAATTTGTCGCAATACGGGTCGCAGATGTATTGTCCGCATGAGTTTACGGTATCCGGAACTGTCACCGCCGATCCAATATGATCGCAAATCGGGGTGACACAATGGACCGCCGTAGATAAACCCTGCGATGCTGCAATAAGGATATGATATCGCGCGCGGGCCGTAAAACCGATCTTGGAAGGCGGGAAGTCTCCGGGAAAAACTCTCTGATAAAGCCTATTACAAGAAGAGCTCGAAGGCAAGATGGGCATGCCCCGTCGACCACACGGGCAAGCTCTGAGAATCGATGTGGTCGCTTAACCAACCCATACGGAGTGAACGAGACCACGCGGGCGGTTCTTGGTACGCATGATTCCTATTGGTTCTGCCGGGCGTGTGCAGGATTGTTCACTCCCCACCCTGTCGCTCACGAACGCGCTGGTTGCTTAAACCGACCGGAAATTCTGTAGCCGCCCCGTAAGTTTAACGCTTTGAAATACTCCACATGTGCGTACCGGGTCTGATCGCTTACGTGGCGCCACTATGTTAGGAGCTCATAGATATCGATGAATCAAATGTCTTTCATCGCTCCTTAAACAACCTGACGTATTCGCAAAATTGCGCGTATTGAGAAGGGAAAGTTAAAGGAACGATAACAATGAGTCTGCTTTCACCGGCTGCATAACGGGATCGCGCGCTATGGGATTTCCTAACTATAATTCGTGTCGATACTCAGACGCGTTGTACAGGTAAGAAGTCGGCGGGACAGTATTTGAGAAGGGGCTCTGCGGCACCAACGCCGAGCTGTATCAGGGGGGTTAATGTGTAGCGGGCATATAACACAATACAGCCCGCGGCGCGTCGTGGTTACCGTAGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAACACCGGAGCTAGGATCCACGACTACCAGTGGGAAACTGTGAATTGTGCATGGTAATTAAAGGATGACTGGTCAACACCGGTCTCCACGGGCGTTAAACAACCTCGCTCCAGTCAATCTCTAGCGGTGGTTGTGGCAGCTTATTCCTGGAGGTAATACTCTTCCGGGCCCACTAAAAATGTAACGAAGTCGAGGTTGGGTCAGGGGATTGAGTGGGGGCGACTCACTGATTCCACCAGGAATTGTCGTCAATCGCGACGTACTTTGAGCCTTGTATCTTGGCGTTTCTTGTTGGTACGCGGCCGTGTTCGTGAATCACGACGTCGTTCATGATTCATCCGTCCAAGCCTAGACCTAGCGTAAAAACGGTGTCGATCTGTGCTCCAACCGATGGATGGTTTTTACACAAGTGAACTTCGAGGCTGTGGGACAAACAGCACAACTTGTTCACTGCTGACCGTGGTACTAAACCACGCTTGCTTTCAGCCCTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTCAGATGCGGATCAAGGGTTACTCGAGCCGTTCTGAGGTCCTAAAATTTTAGCCCTTGGTGTTAGCTTCGGTTTAAGAACGTAGGTGCGACGCGGGGGTCCTAGAGCTCCGCGATCTGCACTCCCCACCTGGCACCAAAACGAATCCTGCATAACGGCTCTCTGTGCATGGGGGATGGTCGCAACAACGAGCATAGCTGGCATCACTTCGTTTGCTGTGGATTGCTGTTTTATACAGAATACGGTGGTGATCATCAAAGGAAGCATAATCCACATCGGGCACCCCGGGCCATCGTGCGTTCCCTTATAGCCGGCTTGCATGTTGGGGGAGGAGTAAGGCCGGTAACGTCTCGCAGCACTGTCGCGTAACACAGGTACATCTTTATTTCCGGTGCTGTAGAAGTGGTTTTTCGAAGGCGTAACCCAGAACGACTGATATAATAGTCCACTATTCCCTGGTTTAAGACTTCTACAAAGTTTTACGCAAAGTTACATGCACACTCGGCGACGTAAATATTAGCCTTGCTAAATTGCCACGGATATTAATCCCGAGCCAACCTGTTCCCACTAGCGGTCTACGGTCATAGTCCTTTGTGTAGAGCGTCATTGCGGTTGGGGCCCGTCCGCGGAGGTTCCCCTTATGATCTAACCGCGGTGCAGGTTGACTGAATGCCATACACTATAGAGAAGACGTCTAAGTAGAAACGTTCTTTAAAAATCTTGAACTGACGGCCGAGTATTATCAAGAGAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCATGCACAATAAGGTTAGAAGCAGCAAGCATGTATTCTTTGCATAGAGGCGGTAAAGCCGCCTTGCATACCCAGCAGCAGCCGCGAAGGCCTTACTCCAGAGGACAGAACTTCTCACACAGCGTCCGCATACACCGCGGACGTGACAAGGTTAGATAGCTCTAGTTTGCGGCAACCCTCGCATCAGGCCGACTCACCCGCGCTTGCTACCCGGAGGATGGGTCAAGGGATAAACATAGCACGTTAGTTAAGCCTAACGTCAGTTTTTAGAGTTTACATGCACGACTAAGTGCATCGAAATACACGCCGTTGACAGACCAACAGCGTGTCAACTGGGCCTTGAGAATTGTATCATAATAGCCAAATACGAGGCCAAGTAGTCCGACGAGAGGCACGTAGAGACCACTTTCCCTAAACGATCTGTCGCATTACCCTTTGACTCGCACCCTATGCCTTATGTTCCAAGCAGCACCGAAGTTAGATTTAAGGGCGTATCTATCGGTACCTCGGTTGGGCCGGTCCACAGCTCCAGCTGAATTAGTGCTCACCCCGCTTCGAGGTTGAGTAAGGGTCACTTTTAAAAATATGCTTAAGGGTGATTCACATGACAGTAATCGAATAGTGAGATATAAGTAGGTGCGCCCCGCGCACACATCAAAACTGTGCAGACTGAAACTGAATGCTGGAGGCTGAGGAAAATGAAGATCAGAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGAGAAGAGTGAATGAATAGATCTGCCGCTGAATCCCCGCGTGAGGTTTTTGCGAC Get the maximum consecutive occurrences of the pattern “AGATC” The result should be 37 because it’s the maximum consecutive occurrences given that…

Project Objectives: The final project will require students to master and apply the core python concepts and programming skills acquired during the semester. Students will also apply critical thinking, problem-solving,…

×
New Download