Pattern Finder C++

Given this string that is the sequence:
TGGTTTAGGGCCTATAATTGCAGGACCACTGGCCCTTGTCGAGGTGTACAGGTAGGGAGCTAAGTTCGAAACGCCCCTTGGTCGGGATTACCGCCATTCTAGTAGTCTAACCCCGAACGCGCTCAGGCTTTGAGTTCGCGCAGCATTAAGAAGTCCATGCCGGCACCGAATGTCCCGACGACAGGCAACCAGCACGGATACCCGCCTTGAAGGCGCAATCAGTAGGTCGAGTTACAGAGGCTCCCCCCGAGCTTGTGCTTCCATTGAGTAGGGGCTATAGATATGTAGCACTCAGGTTTAGTAGCGCCCTTTTAACAGCGAGAGCCCGCCTGGTCAGAACCGAACGGCTGATACGCGAGCTGATGGCTAGAGGATGAACACGGTCCTTCTCTTCGCTTCGATCCGGGGTAGTTTTGTAGCGAAGGATAACGCTCTGTGGATTCTCCGAGAATAATCATCAGTACGGTGTGCGTACCCTCTCTTTGATCCACGCCTGGGGCTGGACATAGTCAGGCGCATTTCATCTACTTAACCCCGGTAAGGGCCACGGGCGCGACATCTCCTTACCAGGGTTGTCTTATGCTCGCTTTTCCCAGATGATAAGCATCTCGTTGTAATGAACAGGTACCTAAGAAAACTGAGTTTCGACGACCCGTCGGCTCGTGTTCTTATCTATTGATCTAACCGAGGTGAAGCTCGCCAAAAATTTCGTAATGTAAGAGAGAAATTGAAGGGGTGAATTTTGCACTCTCGTGCATACGTCTTGCTACAATAGCAAGAGCTGTATGCGTGCGACCACTTCACTACCTCTATAGCATGCGATCTCGCAGCCCGGATTGTCGCCTCCTTTGGGCCGCAAAAACGGTATACGGACACACTGCATCTGTGAGCACGCACCAACTCGATGCGCGTAATAGGCATCTGCTCCACCCAGGGGGCAAGGGCACCTGAGGACGATCTGTTCCGAACAGTATATTTGAGCCAATGTTCTATTAGTGAAGGCAAGGTGAGGGCAACTCACACTGGTACCTCGAGGAGTAATCCGATCCATCTAAACTGGCATGCCCGTTCGAGCTCGGGGGGTTCTTGAATTTAGCTGCGTGTACCTCAGGTCTCCTGAAGGTGACACCAAAGTACAAGATAGATAGATAGATAGATAGGTAATATCTGACGTGAATTGCTTACCGCTAGTGAGCGATTTAGGTCACGTCCTCTGAAGATGTACCGTGATCATCGATGAAATGGCTCTGCAGAGCGTTGCTCTTAACTTAGTGGGAGTGTTCCTTTGCAGTCTGATGAAGTCGCTGCATGTTAACTTTGCACTAAGGGCGTTTCCGAACCCTATAGTCATCCTTATTGATTCGCCCTGTCTTACCCAGGATACACTACCGTTCGAGGCTCTTAACGTACCAACGCATGCAGTCAGAAGATGATTCACCATCCAAGCAAATCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTGGCTTTAAAGCACCGAATGTAGTTGGCCATCGGTCTCGGTCACCAATAAGACGGCCTCGTGGGTCACTCGGTCGATGATCTAGGGTCGGGTGCATAGTGTTTCAGGTCGGCGCTCAGGGTTCTTGTCAGGGAAATCTACGGGTGAGTTGGAAAGCGCCGCCAGCGAGATGCCTGTAGGCGATTAGTGTAGAGAGAGCAACATCGGAAAATTGTCCGTGGGGCGCTACGTAAGTGTTCCCAGTATTCTCGTCCAGAGTAAGTCATGCATACCAGTATCAGGCGTCTGTGTGTTACGTTGCAGTGTATCCCGGTAGCGGGAAGCGTATAGAGCGTAACAGACCTGTCCTACAGCACGCAGGATGTCGACCCTTTCTCAGGCACGATACTTCGTGTAACAGCAGTTCCGGTGTCATCTGTAACTGTTCTGTGTTCCATAGTGAAGATATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCGGGCGACCCTGGCAATCAGGCGCCTGCTTATATGACAATTTGTCGCAATACGGGTCGCAGATGTATTGTCCGCATGAGTTTACGGTATCCGGAACTGTCACCGCCGATCCAATATGATCGCAAATCGGGGTGACACAATGGACCGCCGTAGATAAACCCTGCGATGCTGCAATAAGGATATGATATCGCGCGCGGGCCGTAAAACCGATCTTGGAAGGCGGGAAGTCTCCGGGAAAAACTCTCTGATAAAGCCTATTACAAGAAGAGCTCGAAGGCAAGATGGGCATGCCCCGTCGACCACACGGGCAAGCTCTGAGAATCGATGTGGTCGCTTAACCAACCCATACGGAGTGAACGAGACCACGCGGGCGGTTCTTGGTACGCATGATTCCTATTGGTTCTGCCGGGCGTGTGCAGGATTGTTCACTCCCCACCCTGTCGCTCACGAACGCGCTGGTTGCTTAAACCGACCGGAAATTCTGTAGCCGCCCCGTAAGTTTAACGCTTTGAAATACTCCACATGTGCGTACCGGGTCTGATCGCTTACGTGGCGCCACTATGTTAGGAGCTCATAGATATCGATGAATCAAATGTCTTTCATCGCTCCTTAAACAACCTGACGTATTCGCAAAATTGCGCGTATTGAGAAGGGAAAGTTAAAGGAACGATAACAATGAGTCTGCTTTCACCGGCTGCATAACGGGATCGCGCGCTATGGGATTTCCTAACTATAATTCGTGTCGATACTCAGACGCGTTGTACAGGTAAGAAGTCGGCGGGACAGTATTTGAGAAGGGGCTCTGCGGCACCAACGCCGAGCTGTATCAGGGGGGTTAATGTGTAGCGGGCATATAACACAATACAGCCCGCGGCGCGTCGTGGTTACCGTAGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAACACCGGAGCTAGGATCCACGACTACCAGTGGGAAACTGTGAATTGTGCATGGTAATTAAAGGATGACTGGTCAACACCGGTCTCCACGGGCGTTAAACAACCTCGCTCCAGTCAATCTCTAGCGGTGGTTGTGGCAGCTTATTCCTGGAGGTAATACTCTTCCGGGCCCACTAAAAATGTAACGAAGTCGAGGTTGGGTCAGGGGATTGAGTGGGGGCGACTCACTGATTCCACCAGGAATTGTCGTCAATCGCGACGTACTTTGAGCCTTGTATCTTGGCGTTTCTTGTTGGTACGCGGCCGTGTTCGTGAATCACGACGTCGTTCATGATTCATCCGTCCAAGCCTAGACCTAGCGTAAAAACGGTGTCGATCTGTGCTCCAACCGATGGATGGTTTTTACACAAGTGAACTTCGAGGCTGTGGGACAAACAGCACAACTTGTTCACTGCTGACCGTGGTACTAAACCACGCTTGCTTTCAGCCCTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTCTCAGATGCGGATCAAGGGTTACTCGAGCCGTTCTGAGGTCCTAAAATTTTAGCCCTTGGTGTTAGCTTCGGTTTAAGAACGTAGGTGCGACGCGGGGGTCCTAGAGCTCCGCGATCTGCACTCCCCACCTGGCACCAAAACGAATCCTGCATAACGGCTCTCTGTGCATGGGGGATGGTCGCAACAACGAGCATAGCTGGCATCACTTCGTTTGCTGTGGATTGCTGTTTTATACAGAATACGGTGGTGATCATCAAAGGAAGCATAATCCACATCGGGCACCCCGGGCCATCGTGCGTTCCCTTATAGCCGGCTTGCATGTTGGGGGAGGAGTAAGGCCGGTAACGTCTCGCAGCACTGTCGCGTAACACAGGTACATCTTTATTTCCGGTGCTGTAGAAGTGGTTTTTCGAAGGCGTAACCCAGAACGACTGATATAATAGTCCACTATTCCCTGGTTTAAGACTTCTACAAAGTTTTACGCAAAGTTACATGCACACTCGGCGACGTAAATATTAGCCTTGCTAAATTGCCACGGATATTAATCCCGAGCCAACCTGTTCCCACTAGCGGTCTACGGTCATAGTCCTTTGTGTAGAGCGTCATTGCGGTTGGGGCCCGTCCGCGGAGGTTCCCCTTATGATCTAACCGCGGTGCAGGTTGACTGAATGCCATACACTATAGAGAAGACGTCTAAGTAGAAACGTTCTTTAAAAATCTTGAACTGACGGCCGAGTATTATCAAGAGAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCAGATCATGCACAATAAGGTTAGAAGCAGCAAGCATGTATTCTTTGCATAGAGGCGGTAAAGCCGCCTTGCATACCCAGCAGCAGCCGCGAAGGCCTTACTCCAGAGGACAGAACTTCTCACACAGCGTCCGCATACACCGCGGACGTGACAAGGTTAGATAGCTCTAGTTTGCGGCAACCCTCGCATCAGGCCGACTCACCCGCGCTTGCTACCCGGAGGATGGGTCAAGGGATAAACATAGCACGTTAGTTAAGCCTAACGTCAGTTTTTAGAGTTTACATGCACGACTAAGTGCATCGAAATACACGCCGTTGACAGACCAACAGCGTGTCAACTGGGCCTTGAGAATTGTATCATAATAGCCAAATACGAGGCCAAGTAGTCCGACGAGAGGCACGTAGAGACCACTTTCCCTAAACGATCTGTCGCATTACCCTTTGACTCGCACCCTATGCCTTATGTTCCAAGCAGCACCGAAGTTAGATTTAAGGGCGTATCTATCGGTACCTCGGTTGGGCCGGTCCACAGCTCCAGCTGAATTAGTGCTCACCCCGCTTCGAGGTTGAGTAAGGGTCACTTTTAAAAATATGCTTAAGGGTGATTCACATGACAGTAATCGAATAGTGAGATATAAGTAGGTGCGCCCCGCGCACACATCAAAACTGTGCAGACTGAAACTGAATGCTGGAGGCTGAGGAAAATGAAGATCAGAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGTCTAGAGAAGAGTGAATGAATAGATCTGCCGCTGAATCCCCGCGTGAGGTTTTTGCGAC

Get the maximum consecutive occurrences of the pattern “AGATC”
The result should be 37 because it’s the maximum consecutive occurrences given that pattern

×
New Download